Dual Index Sequencing Primer Box. Added the following technical notes to the list of additional resources: • Best Practices for Standard and Bead-Based 

Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. The sequences for the index primers (26 i7 index 1 sequences; 18 i5 index 2 sequences) are available on pages 4 and 8 here. These indices allow for the combinatorial sequencing of up to 468 samples. The oligos are used for standard PCR reactions. Thus, low-cost desalted oligos can be ordered for this purpose anywhere and will work just fine. The HiSeq 4000 uses the grafted p5 index primer which will typically generate the AGATCTCG sequence read from the PhiX adapter in the i5 read. The “lost reads” file contains a percentage of seequences, proportional to the PhiX loaded, with the AAAAAAAA,AGATCTCG index. M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC

Different pairs of index primers are added to individual samples in a second thermocycling step, after initial amplification of the target region. This allows you to mix many samples together (up to 96) and sequence them at the same time. Following sequencing, for example on an Illumina MiSeq,

Illumina Adapter Sequences Document # 1000000002694 v00 1 October 2015 Illumina Adapter Sequences. This document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. These sequences are provided for the sole purpose of understanding and publishing the results of your sequencing experiments. If primer indexes cause variable amplification efficiency among different template DNA in the PCR, the resulting OTU sequence counts will differ among primer index reactions performed on the same environmental sample. Thus, we expect that primer index and library replicates of the same environmental sample should have mean dissimilarity close to 0. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. The sequences for the index primers (26 i7 index 1 sequences; 18 i5 index 2 sequences) are available on pages 4 and 8 here. These indices allow for the combinatorial sequencing of up to 468 samples. The oligos are used for standard PCR reactions. Thus, low-cost desalted oligos can be ordered for this purpose anywhere and will work just fine. The HiSeq 4000 uses the grafted p5 index primer which will typically generate the AGATCTCG sequence read from the PhiX adapter in the i5 read. The “lost reads” file contains a percentage of seequences, proportional to the PhiX loaded, with the AAAAAAAA,AGATCTCG index. M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC

Sequencing Compatibility, This kit produces libraries with Illumina TruSeq Q3: Are the index primers used in RRHP 5-hmC Library Prep kit (D5451) the same 

7 Mar 2016 Index sequences can be added to each sample via ligation after PCR during sequencing library preparation; however, these library indexes can  Illumina reserves all rights in the oligonucleotides and their sequence Nextera Index Kit – PCR Primers . Multiplexing Index Read Sequencing Primer .

Illumina Adapter and Primer Sequences Illumina libraries are normally constructed by ligating adapters to short fragments (100 – 1000bp) of DNA. The exception to this is if Nextera is used (see end of this post) or where PCR amplicons have been constructed that already incorporate the P5/P7 ends that bind to the flowcell. Illumina Paired […]

Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. It involves 96 unique Index 1 (i7) adapters and 96 unique Index 2 (i5) adapters, preventing repeated sequences in a well plate. Along with other best practices, the unique dual indexing strategy will help make sure that your libraries will demultiplex with high accuracy across all Illumina sequencing platforms. However, in some cases, primer-blast cannot determine if a database sequence is an intended target or not, thus the user guidance might be helpful (For example, when your template is a polymorphic form or a partial region of an entry in the search database, or when the database such as the nr contains redundant entries of your template). M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC Illumina Adapter Sequences Document # 1000000002694 v00 1 October 2015 Illumina Adapter Sequences. This document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. These sequences are provided for the sole purpose of understanding and publishing the results of your sequencing experiments. If primer indexes cause variable amplification efficiency among different template DNA in the PCR, the resulting OTU sequence counts will differ among primer index reactions performed on the same environmental sample. Thus, we expect that primer index and library replicates of the same environmental sample should have mean dissimilarity close to 0. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification.

18 Jan 2016 Using dedicated primers for the index reads, placed immediately upstream of the index sequence is the most efficient and accurate method for 

There are three sequencing primers: Read 1, Read 2, and Index. Read 1 primer will sequence one direction, Read 2 primer will sequence the reverse direction,  2 May 2019 Table 2. List of indexes supplied with the iDeal Library Preparation Kit. Product. Index Primer Sequence. Expected index Primer. Each of our index primers contains a unique barcode sequence with 6 bases that can be used to identify libraries. Library multiplexing up to 48 samples is possible   As a young and dynamic company, specialized in life sciences applications for R&D and diagnostics, we are dedicated to deliver premium quality products for  Amplify and tag DNA-seq libraries with SMARTer DNA index PCR primers with all of our DNA-seq kits to generate libraries for use in multiplexed sequencing 

It involves 96 unique Index 1 (i7) adapters and 96 unique Index 2 (i5) adapters, preventing repeated sequences in a well plate. Along with other best practices, the unique dual indexing strategy will help make sure that your libraries will demultiplex with high accuracy across all Illumina sequencing platforms. However, in some cases, primer-blast cannot determine if a database sequence is an intended target or not, thus the user guidance might be helpful (For example, when your template is a polymorphic form or a partial region of an entry in the search database, or when the database such as the nr contains redundant entries of your template). M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC Illumina Adapter Sequences Document # 1000000002694 v00 1 October 2015 Illumina Adapter Sequences. This document provides the nucleotide sequences that comprise Illumina oligonucleotides used in Illumina sequencing technologies. These sequences are provided for the sole purpose of understanding and publishing the results of your sequencing experiments. If primer indexes cause variable amplification efficiency among different template DNA in the PCR, the resulting OTU sequence counts will differ among primer index reactions performed on the same environmental sample. Thus, we expect that primer index and library replicates of the same environmental sample should have mean dissimilarity close to 0. Note that the index read primer is complementary to the Read 2 sequencing primer (see diagram below). This is used to sequence the hexamer index tag in the forward direction after read 1 is complete, before the reverse strand is synthesised by bridge amplification. The sequences for the index primers (26 i7 index 1 sequences; 18 i5 index 2 sequences) are available on pages 4 and 8 here. These indices allow for the combinatorial sequencing of up to 468 samples. The oligos are used for standard PCR reactions. Thus, low-cost desalted oligos can be ordered for this purpose anywhere and will work just fine.